In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.
Haplogroup Q is a branch of haplogroup P (M45). It is believed to have arisen in Siberia approximately 15,000 to 20,000 years ago.
This haplogroup contains the patrilineal ancestors of many Siberians, Central Asians, and indigenous peoples of the Americas. Haplogroup Q Y-chromosomes are also found scattered at a low frequency throughout Eurasia.[1] This haplogroup is surprisingly diverse despite its low frequency among most populations outside of Siberia or the Americas, and at least six primary subclades have been sampled and identified in modern populations.
A migration from Asia into Alaska across the Bering Strait was done by haplogroup Q populations approximately 15,000 years ago. This founding population spread throughout the Americas. Once in the Americas, haplogroup Q underwent a mutation, producing its descendant population defined by the M3 SNP.
Geographical distribution
In the Old World the Q lineage and its many branches is largely found within a huge triangle defined by Norway in the West, Iran in the South and Mongolia in the East. There is also a rough correlation between the Turkic-speaking peoples of Central Eurasia and Q. The frequency of Q in Norway and Mongolia is about 4% while in the Iranian cities of Shiraz and Esfahan, the frequency runs between 6% and 8%; Iranian samples of haplogroup Q belong almost exclusively to the M25 defined subclade. In the middle of this triangle, in Uzbekistan and Turkmenistan, the frequency of Q runs between 10% and 14%. Only two groups in the Old World are majority Q groups. These are the Selkups (~70%) and Kets (~95%). They live in western and middle Siberia and are small in number, being just under 5,000 and 1,500, respectively.
Technical specification of mutation
The technical details of M242 are:
- Nucleotide change: C to T
- Position (base pair): 180
- Total size (base pairs): 366
- Forward 5′→ 3′: aactcttgataaaccgtgctg
- Reverse 5′→ 3′: tccaatctcaattcatgcctc
Subgroups
The subclades of Haplogroup Q with their defining mutation(s), according to the 2006 ISOGG tree:
- Q (MEH2, M242, P36)
- Q*
- Q1 (M120, N14 (M265)) Found at low frequency among Chinese, Koreans, Dungans, and Hazara[2][3]
- Q1*
- Q1a (M378) Found at low frequency among samples of Hazara and Sindhis
- Q2 (M25, M143) Found at low to moderate frequency among some populations of Southwest Asia, Central Asia, and Siberia
- Q3 (M3) Typical of indigenous peoples of the Americas
- Q3*
- Q3a (M19) Found among some indigenous peoples of South America, such as the Ticuna and the Wayuu[4]
- Q3b (M194)
- Q3c (M199)
- Q4 (P48)
- Q5 (M323) Found in a significant minority of Yemeni Jews
- Q5 or Q7 (SS4BP) Presently found in India only BMC Evolutionary Biology 2007
- Q6 (M346) Found at low frequency in Pakistan and India
Coming Changes
A major revision of the Q tree is expected to be published in early 2008.[citation needed] If no other SNPs are found then the new tree will look like this.
- Q (M242)
- Q*
- Q1 (MEH2, P36.2)
- Q1*
- Q1a (M120, N14 (M265)) Found at low frequency among Chinese, Koreans, Dungans, and Hazara[5][6]
- Q1b (M25, M143) Found at low to moderate frequency among some populations of Southwest Asia, Central Asia, and Siberia
- Q1c (M346) Found at low frequency in Pakistan and India
- Q1c*
- Q1c1 (M3) Typical of indigenous peoples of the Americas
- Q1c1*
- Q1c1a (M19) Found among some indigenous peoples of South America, such as the Ticuna and the Wayuu[7]
- Q1c1b (M194)
- Q1c1c (M199, P106, P292)
- Q1d (P48)
- Q1e (P89)
- Q1f (M323) Found in a significant minority of Yemeni Jews
- Q1g (M378) Found at low frequency among samples of Hazara and Sindhis
References
- ^ High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas, Stephen L. Zegura, Tatiana M. Karafet et al., 2003
- ^ Supplementary Table 2: NRY haplogroup distribution in Han populations, from the online supplementary material for the article by Bo Wen et al., "Genetic evidence supports demic diffusion of Han culture," Nature 431, 302-305 (16 September 2004)
- ^ Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region, from the article by R. Spencer Wells et al., "The Eurasian Heartland: A continental perspective on Y-chromosome diversity," Proceedings of the National Academy of Sciences of the United States of America (August 28, 2001)
- ^ "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas," Maria-Catira Bortolini et al., American Journal of Human Genetics 73:524-539, 2003
- ^ Supplementary Table 2: NRY haplogroup distribution in Han populations, from the online supplementary material for the article by Bo Wen et al., "Genetic evidence supports demic diffusion of Han culture," Nature 431, 302-305 (16 September 2004)
- ^ Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region, from the article by R. Spencer Wells et al., "The Eurasian Heartland: A continental perspective on Y-chromosome diversity," Proceedings of the National Academy of Sciences of the United States of America (August 28, 2001)
- ^ "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas," Maria-Catira Bortolini et al., American Journal of Human Genetics 73:524-539, 2003
- The India Genealogical DNA Project
See also
|